il 2 signal peptide sequence IL

Garrett Long logo
Garrett Long

il 2 signal peptide sequence sequences - Interleukin-2 structure IL Unraveling the IL-2 Signal Peptide Sequence: A Crucial Element in Protein Secretion and Function

Commonsignal peptidesequences The IL-2 signal peptide sequence plays a pivotal role in the biological journey of Interleukin-2 (IL-2), a critical cytokine produced primarily by activated CD4-positive helper T-cells. Understanding this signal peptide is fundamental for comprehending how Interleukin-2 is directed for secretion and how its function can be modulated2ERJ: Crystal structure of the heterotrimeric interleukin-2 .... This article delves into the intricacies of the IL-2 signal peptide sequence, exploring its structure, function, and implications in various biological and biotechnological contexts, drawing upon extensive scientific dataGene - IL2 interleukin 2 [Homo sapiens (human)] - NCBI - NIH.

The Role of Signal Peptides in Protein Secretion

Signal peptides, also known as leader sequences, are short amino acid sequences typically found at the N-terminus of nascent secreted proteins. They act as molecular addresses, guiding the protein to the endoplasmic reticulum for translocation into the secretory pathwaySignal peptides(SP) are shortpeptideslocated in the N-terminal of proteins, carrying information for protein secretion. They are ubiquitous to all .... This process is essential for proteins destined for secretion outside the cell or for insertion into cellular membranes. The IL-2 signal peptide performs this crucial task for Interleukin-2.IL-2 Signal (CVCM82) Research indicates that signal peptides characteristically possess three domains: an N-terminal basic region, a central hydrophobic core, and a C-terminal cleavage site. The IL-2 signal peptide sequence, for instance, has been described as having this tripartite structure, facilitating its proper function作者:L Zhang·2005·被引用次数:161—Signal peptides, located at the N-terminus of nascent secreted proteins, characteristically have three domains: (1) a basic domain at the N- ....

The Specific IL-2 Signal Peptide Sequence and Its Significance

While the precise IL-2 signal peptide sequence can vary slightly across species, the human IL-2 signal peptide is often represented by sequences such as MRRMQLLLLIALSLALVTNS. This sequence is critical for the efficient secretion of mature IL-2. Modifications to this signal peptide have been shown to significantly impact protein secretion.Construction of expression plasmids containing the wild- ... For example, studies have demonstrated that altering the IL-2 signal peptide can augment protein secretion both *in vitro* and *in vivo*, suggesting that optimizing signal peptides should be a key consideration in protein expression systems. One notable example of a specific IL-2 signal peptide sequence used in research is ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACGAATTCG, which has been utilized in constructs for protein secretion.

Applications and Research Implications

The detailed understanding of the IL-2 signal peptide sequence has profound implications in various research and biotechnological applications.The Long Signal Peptide Isoform and Its Alternative ...

* Recombinant Protein Production: For the production of recombinant IL-2 or fusion proteins incorporating IL-2, the correct signal peptide is paramount.Signal Peptide Database Researchers often employ mammalian expression vectors with C-terminal IL-2 signal peptide or fuse the IL-2 signal peptide to the N-terminus of a gene of interest to ensure proper secretionAlthough most type I membrane-bound proteins havesignal peptides, most type II and multi-spanning membrane-bound proteins are targeted to the secretory pathway by their first transmembrane domain, which biochemically resembles a signalsequenceexcept that it is not cleaved. They are a kind of target peptide.. For instance, the interleukin 2 (IL2) signal peptide MRRMQLLLLIALSLALVTNS has been extensively used to facilitate protein secretion. The IL2 gene / cDNA is a protein-coding gene, and its efficient expression relies heavily on the functional signal peptidepCDNA3 IL-2 signal mFc (Plasmid #128042).

* Modulating Immunogenicity: The signal peptide can influence the immunogenicity of a protein. Research has explored how different leader sequences, including those from secreted molecules like Interleukin-2, can affect the immune response to epitope vaccines. This highlights the importance of the leader sequence in eliciting desired immunological outcomes.pcDNA3-IL-2 signal (Plasmid #128028)

* Protein Engineering and Optimization: Researchers are continuously investigating ways to optimize protein secretion. Studies have focused on assessing different signal peptides to enhance the expression of IL-2 in systems like *E. coli*. Furthermore, advanced techniques, such as signal peptides generated by attention-based neural networks, are being explored to design more effective signal sequences.Tumor-infiltrating mast cells stimulate ICOS(+) regulatory T cells through anIL-33 andIL-2axis to promote gastric cancer progression.

* Understanding Protein Trafficking: The study of signal peptides is integral to understanding fundamental cellular processes like protein trafficking and folding. The IL-2 signal peptide serves as a model for investigating these mechanisms, contributing to a broader understanding of how proteins are directed to their cellular destinations.

Databases and Resources

Several databases provide valuable information on signal peptides, including the Signal Peptide Database. These resources often contain entries for specific proteins like IL2_HUMAN (human Interleukin-2) and IL2_MUSSP (mouse Interleukin-2), offering detailed sequences and related information.作者:L Zhang·2005·被引用次数:161—Modification of theIL-2 signal peptideaugments protein secretion both in vitro and in vivo. As a result, optimizing thesignal peptideshould be considered. These databases are crucial for researchers working with IL-2 or other secreted proteins.

In conclusion, the IL-2 signal peptide sequence is a critical determinant of Interleukin-2's secretion and subsequent biological activity.2016年5月2日—1. the gene of interest should be placed immediately after thesignal sequencefor the production with a native end. You don't need the ATG but can have it if ... Its specific amino acid composition dictates its targeting function, and modifications to this sequence can significantly alter protein expression levels. Ongoing research continues to illuminate the complex interplay between signal peptides and protein function, paving the way for advancements in biotechnology and a deeper understanding of cellular biology.Assessment of Signal Peptides to Optimize Interleukin 2 (IL ... The IL-2 signal peptide remains a key area of study for those involved in protein engineering, immunology, and molecular biology.

Log In

Sign Up
Reset Password
Subscribe to Newsletter

Join the newsletter to receive news, updates, new products and freebies in your inbox.